| Sp | Marker | Primer | Seq | Repeat_motif | Repeat_motif_nr | Binding_Temperature | Reference |
| Typha_latifolia | TL 146 | F | GGACTACGGTCCTTCTTTTT | (AT)7 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 146 | R | TGACAAGCACATTATTGACTTT | (AT)7 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 209 | F | TGTCCTTTTTGTGTCACTTG | (AG)6 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 209 | R | TGCGTTATAGATGATATGGTTT | (AG)6 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 247 | F | AGGCTAGCTAATAAGCCCTAA | (AAT)4 | 3 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 247 | R | TCGAATACCCTTGAGAATGT | (AAT)4 | 3 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 305 | F | CTTACCAGTTCCAAATTCCA | (CT)6 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 305 | R | AGCATGCTTAACAACCAAGT | (CT)6 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 368 | F | ATTATTCCCTTGCAGACCA | (GT)8 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TL 368 | R | GAATTGAAGTCCTCCTATCAAA | (GT)8 | 2 | 62 | Ciotir, C., M. Dorken, and J. Freeland. 2013. Preliminary characterization of Typha latifolia and T. angustifolia from North America and Europe based on novel microsatellite markers identified through next-generation sequencing. Fundam. Appl. Limnol. 182:247–252. |
| Typha_latifolia | TA3 | F | GAGTTGGGAAGAAGGGATTA | (AC)12...(AG)13 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | TA3 | R | TGGATACGGCAGTGTTA | (AC)12...(AG)13 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | TA7 | F | ATTCAACCCAAACTCTAACAA | (AC)9...(AG)17 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | TA7 | R | CACCCAAAGGACCACATT | (AC)9...(AG)17 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | TA8 | F | TCTTCGCTGAAAGTGACATAC | (AC)11 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | TA8 | R | ATTGGCTTCGTTGGATT | (AC)11 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | T20 | F | FAM ATGCCTAGTGAGGATTC | (AG)10 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | T20 | R | CACACTTATTTTCGAACAA | (AG)10 | 2 | 60 | Tsyusko-Omeltchenko, O. V., N. A. Schable, M. H. Smith, and T. C. Glenn. 2003. Microsatellite loci isolated from narrow-leaved cattail Typha angustifolia. Mol. Ecol. Notes 3:535–538. |
| Typha_latifolia | Tmin01 | F | CTTCTTCTCGTGTCCACCG | (AG) | 2 | 57 | Csencsics, D., S. Brodbeck, and R. Holderegger. 2010. Cost-effective, species-specific microsatellite development for the endangered dwarf bulrush (Typha minima) using next-generation sequencing technology. J. Hered. 101:789–793. |
| Typha_latifolia | Tmin01 | R | TGCAGTACGGCCTCATCG | (AG) | 2 | 57 | Csencsics, D., S. Brodbeck, and R. Holderegger. 2010. Cost-effective, species-specific microsatellite development for the endangered dwarf bulrush (Typha minima) using next-generation sequencing technology. J. Hered. 101:789–793. |
| Lycopus europaeus | L_10 | F | TCAAGGAAAATCAGCAAGATTC | (TC)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_10 | R | CCAATCTGTGGTATTCGAACTG | (TC)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_11 | F | CTCGAGAGCGAAGGCAAA | (CT)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_11 | R | CCTGAGAAGAGTTCATTGAGCA | (CT)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_15 | F | GATACTGGCGTAGAAGATCGAA | (GA)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_15 | R | TCACGTTTACTGCATGTGGTC | (GA)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_16 | F | GATTTTCTGCCGGCTTACAC | (TC)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_16 | R | CAAACTGTGTTGGAATGGCA | (TC)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_17 | F | GCCCTTCTTTTTGTGGTCG | (TC)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_17 | R | CGGAGCTTCCTCTCAACAAC | (TC)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_18 | F | CAGATCTGGGACACCGCT | (TG)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_18 | R | TCCAGCAAAACGTTACATGC | (TG)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_19 | F | TTCATATTGCTCGTGATTCATT | (GA)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_19 | R | GCATGTATTTTGGTTAGATATCAGG | (GA)13 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_23 | F | GATGCTCTCAAAGAGGTGGG | (TCT)14 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_23 | R | GAGAAACCTAGACTCCACAACTGA | (TCT)14 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_33 | F | GATGATGGGAATAAGCCGTG | (GA)16 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_33 | R | TCATTTTCTTCGCAGCATGA | (GA)16 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_35 | F | CTCGCTCTGCAGAAACACAA | (AC)17 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_35 | R | AAGACAGAGTTCTCGTGCCA | (AC)17 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_38 | F | TAGACATGCTTTGTTTGATTGATATT | (CA)18 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_38 | R | GACAGCAGCACCTGCAAAT | (CA)18 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_40 | F | GTATAGGAAAAGGGAAGGAAAAA | (GA)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_40 | R | CAAGTACACGGTGAGATTCTGC | (GA)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_42 | F | TACAAAAGGAGTCGCACCGT | (AG)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_42 | R | GGGAACAAGCTTTTGGCTTT | (AG)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_45 | F | ACCATTCTACAATGCAACCG | (GA)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_45 | R | ACAAAACACATCATGGCATATCA | (GA)19 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_48 | F | GGCACTAGTTCCACTTAATTGCC | (CA)10 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Lycopus europaeus | L_48 | R | TGCAGAAATGGTAGGATAATGG | (CA)10 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_01 | F | AGTCGCAAGTTAAAGGGAAGC | (AGC)6 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_01 | R | GGAGCATACTCTTGGGAGAGG | (AGC)6 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_03 | F | AATGTCATTCATCCCACCAC | (TTG)7 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_03 | R | TGGGTTCCATGCAAAATTATC | (TTG)7 | 3 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_10 | F | ACATCGATCTGGGCTGGTAA | (CA)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_10 | R | ATTTAATTCAAGGCGTTGCG | (CA)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_13 | F | ACACAAGATTTATAATCTGGCAAA | (AC)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_13 | R | GCAATGACATAGTCCAAGCTG | (AC)11 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_17 | F | ATCTCAGTGTTATGTGCTGTGTAGA | (TC)12 | 2 | 54 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_17 | R | TCACCGGGCGTTGAATAATA | (TC)12 | 2 | 54 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_18 | F | TACACGAAAGCGACGGTGAT | (AG)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_18 | R | CATCAGGGTCCGATATGACA | (AG)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_20 | F | TTACCGTATTGTTAATTTTACCGGAG | (TC)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_20 | R | TTGCTCGAATTCCAACATAAA | (TC)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_21 | F | CACCCAACAAGAAACAGTACTATAAA | (AG)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_21 | R | TCAAAGCATTCTTGGCCTTC | (AG)12 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_28 | F | GCACTGTCCCGGTAAGTCTG | (GT)13 | 2 | 54 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_28 | R | AAGTTTGACTGATAAGGTTTCCA | (GT)13 | 2 | 54 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_32 | F | AGAAAACGGGGACGAAGAAG | (TG)13 | 2 | 55 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_32 | R | CACCAAGAAGCGACTCCACT | (TG)13 | 2 | 55 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_37 | F | TCGATAGCCACAAGAGCAAA | (GA)15 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_37 | R | TTACAATCATGGCTTCGTGA | (GA)15 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_38 | F | CAATCCAACACTCTCATTTTCC | (AC)15 | 2 | 55 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_38 | R | TCCTAAGCAAAGTCATCAATGC | (AC)15 | 2 | 55 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_47 | F | CCATCGATAGCATCCAGGTA | (TG)18 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Oenanthe aquatica | O_47 | R | AATAGTAATTAGGAATCTCACGCAC | (TG)18 | 2 | 57 | Favre-Bac, L., C. Godé, and J.-F. Arnaud. 2014. Characterization of polymorphic microsatellite markers for the fine-leaved water-Dropwort Oenanthe aquatica and the Gypsywort Lycopus europaeus, two farmland remnant wetland species. Conserv. Genet. Resour. 6:995–998. |
| Phragmites australis | PaGT4 | F | TGCTCCCTGCCAGTTTCTTG | (CA)9 | 2 | 56 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT4 | R | TATCCACCCTTCGAAGGCAC | (CA)9 | 2 | 56 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT8 | F | TCTGAACATAATCCTGGTGG | (CA)8 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT8 | R | TCTGTGTGAAGCAGTTCTGC | (CA)8 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT9 | F | CCATGTGTTAATGTTGTCC | (CA)10 | 2 | 46 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT9 | R | ATTGAATCCACACGTTTCCG | (CA)10 | 2 | 46 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT11 | F | CAACTCCGTGAATGACATGC | (CA)8 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT11 | R | CAGTTTGTGCACTAATGGAC | (CA)8 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT12 | F | CTTCCTAGGTCAGTATCATCC | (CA)9 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT12 | R | GTGGCAGCTGATTGATTTGG | (CA)9 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT13 | F | CTCATGCATCACTTCACAGG | (CA)9 | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT13 | R | ACACGGACCTAACATCAACC | (CA)9 | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT14 | F | GTTGCAGCAAGTATTTGG | (CA)7 | 2 | 46 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT14 | R | CAAGCATTCTAGTAGTAGC | (CA)7 | 2 | 46 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT16 | F | ACCAATCAGTCAGACTAGCC | (CA)10 | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT16 | R | GTTCTCATGTTGGAGAAGCC | (CA)10 | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT21 | F | GCTACTCAACAGGTATACGG | (CA)5 (AT)6 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT21 | R | ATTGAGGATTGAGGTGGTGG | (CA)6 | 2 | 50 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT22 | F | TTGAGTGCCTGGTGTATTCG | (AC)8CTT | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |
| Phragmites australis | PaGT22 | R | AAGCTTCTGTCATGGAACCG | (GA)5 | 2 | 52 | Saltonstall, K. 2003. Microsatellite variation within and among North American lineages of Phragmites australis. Mol. Ecol. 12:1689–1702. |